structure and describe your strategy

BS934 Assignment 1 for 2022/2023:

 

Understanding gene structure, PCR

 

In answering this task, please, do not upload more than 2 A4 pages onto FASER by 15 November 2022. Total maximal word count: 1000. Cite references or web sites where appropriate.

Please, structure and describe your strategy in sufficient detail so it could actually be implemented. Explain your choices and rational briefly. Indicate sequences (e.g., primer sequences) where applicable. Please, keep in mind that there is not ONE solution to this task, but several options and you need only to identify one route. Please, decide on only ONE route and describe it. What is important is that you briefly explain and justify your choices.

 

  1. Identify an interesting full-length cDNA that you may wish to amplify from a gene coding for a protein that is around 20 kDa or smaller. Outline briefly what is the function of the gene product, why is it is interesting (100 words max). If there are multiple cDNA species because of alternative splicing, choose one.
  2. Find the sequence for the cDNA and the corresponding amino acid sequence and use a relevant public data base to find out and illustrate in a scheme how the mRNA relates to the gene as found in the genome (or download such a relevant scheme as shown below in the example).
  3. Identify the open reading frame of the cDNA (coding sequence) and design a primer pair to amplify the full-length coding sequence. Indicate the primer sites in the sequence. Write out the primer pair as you would order it.
  4. Design and describe in sufficient detail the PCR protocol to amplify the sequence from a cDNA mixture (which you can obtain commercially). 150 words max.
  5. Outline a method you can employ to test if your PCR product is what you expected, what would you expect from this method? (50 words max).

 

Hints:

Below and I provide an example what some of what I would like to see and the assessment criteria.

Good candidate gene products may be cytokines, interleukins, interferons, peptide hormones.

 

To find a MRNA sequence, I suggest to look into:

www.ncbi.nlm.nih.gov/

 

To find info about the gene structure, go, for example, here, you can also find info on cDNA:

http://www.ensembl.org/Homo_sapiens/

This site will also lead you to mRNA/cDNA sequences and a lot of information

 

To translate a cDNA sequence into amino acid sequence, you can also use this site:

https://web.expasy.org/translate/

Remember the best format to work with sequences is FASTA

 

Some information on setting up a standard PCR reaction may be found here:

https://www.sigmaaldrich.com/GB/en/technical-documents/protocol/genomics/pcr/standard-pcr?gclid=CjwKCAjwoP6LBhBlEiwAvCcthOW1FAvkYGfTdFQtJV5RCH8OuwSLr23-wy0R_C6BotWeQ0yFjQIX_RoCs4UQAvD_BwE

 

Example:

  1. Yeats4:

Yeats4, expressed from gene GAS41 (glioma amplified 41) is a protein subunit of several chromatin remodelling complexes involved in gene activation [1,2]. Its expression has been linked to several cancers [3,4]. We wish to clone the ORF into a bacterial expression vector to test if it interacts with specifically modified nucleosomes.

References:

  1. Hsu C-C, Shi J, Yuan C, Zhao D, Jiang S, Lyu J, et al. Recognition of histone acetylation by the GAS41 YEATS domain promotes H2A.Z deposition in non-small cell lung cancer. Genes Dev. 2018;32:58–69.
  2. Fischer U, Meltzer P, Meese E. Twelve amplified and expressed genes localized in a single domain in glioma. Hum Genet. 1996;98:625–8.
  3. Li Y, Li L, Wu J, Qin J, Dai X, Jin T, et al. YEATS4 is associated with poor prognosis and promotes epithelial-to-mesenchymal transition and metastasis by regulating ZEB1 expression in breast cancer. Am J Cancer Res. 2021;11:416–40.
  4. Kiuchi J, Komatsu S, Imamura T, Nishibeppu K, Shoda K, Arita T, et al. Overexpression of YEATS4 contributes to malignant outcomes in gastric carcinoma. Am J Cancer Res. 2018;8:2436–52.

 

  1. Gene structure, from ensemble:

 

  1. From ensemble, 5’ and 3’ untranslated regions in yellow highlights

 

1 CCGTTGCGCCTGCGCGCGGTGCGGCCGTCGCCCCTCTTTTCGCGGCGTTCTCCACCTGCG   60

……………………………………………………

……………………………………………………

 

61 CGGGCCTGAATGGCCTTCAGGAGCACAGTCGGCCTGAGGAGTTGACGGTTACTCACCGCC  120

……………………………………………………

……………………………………………………

 

121 GTGAGCCCAAGTAACTCGCCCTCCTTCGGCTAGAAACCCTCCGCCTGGGCCCGCGCGACA  180

……………………………………………………

……………………………………………………

 

181 GGAGCGCGGTCTCTGAGGGGAGCGGCGACCCCGCCAGCCCCGGTCTCTTTCCCTGGCGGC  240

……………………………………………………

……………………………………………………

 

241 GGCGGCTTCTTCCGTGGGACAATATGTTCAAGAGAATGGCCGAATTTGGGCCTGACTCCG  300

…………………..ATGTTCAAGAGAATGGCCGAATTTGGGCCTGACTCCG   37

…………………..‑M‑‑F‑‑K‑‑R‑‑M‑‑A‑‑E‑‑F‑‑G‑‑P‑‑D‑‑S‑‑   12

 

301 GCGGGAGAGTAAAGggtgttactatcgttaaaccaatagtttacggtaatgttgctcggt  360

38 GCGGGAGAGTAAAGGGTGTTACTATCGTTAAACCAATAGTTTACGGTAATGTTGCTCGGT   97

13 G‑‑G‑‑R‑‑V‑‑K‑‑G‑‑V‑‑T‑‑I‑‑V‑‑K‑‑P‑‑I‑‑V‑‑Y‑‑G‑‑N‑‑V‑‑A‑‑R‑‑   32

 

361 attttggaaagaaaagagaagaagatgggcacactcatcagtggacagtatatgtgaaac  420

98 ATTTTGGAAAGAAAAGAGAAGAAGATGGGCACACTCATCAGTGGACAGTATATGTGAAAC  157

33 Y‑‑F‑‑G‑‑K‑‑K‑‑R‑‑E‑‑E‑‑D‑‑G‑‑H‑‑T‑‑H‑‑Q‑‑W‑‑T‑‑V‑‑Y‑‑V‑‑K‑‑   52

 

421 catatagaaatgagGTAACCCTGTATCATTTGCTAAAGCTGTTTCAATCAGACACCAATG  480

158 CATATAGAAATGAGGTAACCCTGTATCATTTGCTAAAGCTGTTTCAATCAGACACCAATG  217

53 P‑‑Y‑‑R‑‑N‑‑E‑‑V‑‑T‑‑L‑‑Y‑‑H‑‑L‑‑L‑‑K‑‑L‑‑F‑‑Q‑‑S‑‑D‑‑T‑‑N‑‑   72

 

481 CAATGCTGGGGAAAAAGACAGTGGTTTCAGAGTTCTATGATGAAATGatatttcaagacc  540

218 CAATGCTGGGGAAAAAGACAGTGGTTTCAGAGTTCTATGATGAAATGATATTTCAAGACC  277

73 A‑‑M‑‑L‑‑G‑‑K‑‑K‑‑T‑‑V‑‑V‑‑S‑‑E‑‑F‑‑Y‑‑D‑‑E‑‑M‑‑I‑‑F‑‑Q‑‑D‑‑   92

 

541 caacagcaatgatgcaacaattattgacaacatctcgtcagctaacattaggagcctata  600

278 CAACAGCAATGATGCAACAATTATTGACAACATCTCGTCAGCTAACATTAGGAGCCTATA  337

93 P‑‑T‑‑A‑‑M‑‑M‑‑Q‑‑Q‑‑L‑‑L‑‑T‑‑T‑‑S‑‑R‑‑Q‑‑L‑‑T‑‑L‑‑G‑‑A‑‑Y‑‑  112

 

601 agcatgaaacagaatTTGCAGAGCTTGAAGTGAAAACCAGAGAAAAATTAGAAGCTGCTA  660

338 AGCATGAAACAGAATTTGCAGAGCTTGAAGTGAAAACCAGAGAAAAATTAGAAGCTGCTA  397

113 K‑‑H‑‑E‑‑T‑‑E‑‑F‑‑A‑‑E‑‑L‑‑E‑‑V‑‑K‑‑T‑‑R‑‑E‑‑K‑‑L‑‑E‑‑A‑‑A‑‑  132

 

661 AGAAAAAAACAAGCTTTGAGATTGCAGAGCTTAAGGAGAGATTAAAAGCAAGTCGTGAAA  720

398 AGAAAAAAACAAGCTTTGAGATTGCAGAGCTTAAGGAGAGATTAAAAGCAAGTCGTGAAA  457

133 K‑‑K‑‑K‑‑T‑‑S‑‑F‑‑E‑‑I‑‑A‑‑E‑‑L‑‑K‑‑E‑‑R‑‑L‑‑K‑‑A‑‑S‑‑R‑‑E‑‑  152

 

721 CTATAAATTGTTTAAAAAATGAAATCAGAAAACTTGAAGAAGATGACCAAGCAAAAGACA  780

458 CTATAAATTGTTTAAAAAATGAAATCAGAAAACTTGAAGAAGATGACCAAGCAAAAGACA  517

153 T‑‑I‑‑N‑‑C‑‑L‑‑K‑‑N‑‑E‑‑I‑‑R‑‑K‑‑L‑‑E‑‑E‑‑D‑‑D‑‑Q‑‑A‑‑K‑‑D‑‑  172

 

781 TATAAACAGTTCTCATGAGAACTTGGTAGTAAGCTAAACTGAAAATAAGGTGGGCTTCAC  840

518 TATAA……………………………………………….  522

173 I‑‑*‑……………………………………………….  173

 

841 TGGAGAAATGGACTTACTGCAAATGCTGTGATGTTTCTTAGAGGAACTTCATATACAGCT  900

……………………………………………………

……………………………………………………

 

901 GTTGACCATGAATTTCTTAGCAATAGGAATTTGTACTATTTAAGCAATCTTTAATGGAAA  960

……………………………………………………

……………………………………………………

 

961 ATATGTGTGTAAGAATGGATGCTATATAGGTATTTTACCAACCCATTTTAAGAAAATTCT 1020

……………………………………………………

……………………………………………………

 

1021 ATGATATTAAGCACAGTTTTTAAAAATGTTTATTGTAGTATATGTATAGCTTATTACCCT 1080

……………………………………………………

……………………………………………………

 

1081 TTTGACAGGCATCAAAATTT                                         1100

………………..

………………..

 

Forward primer:  ATGTTCAAGAGAATGGCCGAA Tm ~ 58

Reverse primer: TATGTCTTTTGCTTGGTCATCTT Tm ~ 58

In 50 µl thin walled 200 µl PCR tube, set up 1x PCR buffer from Sigma Aldrich (P2317), 0.2 mM dNTP mix, 0.1 µM of each forward and reverse primer, 0.05 units Tag polymerase from Sigma Aldrich (D1806), 0.1 mM MgCl2, 10 ng cDNA mix. Initial denaturation is at 94°C for 4 min, followed by 30 cycles of 94°C for 1 min, 55°C for 30 sec, 72°C for 1 min followed by a final extension at 72°C for 5 min.

 

For question 5 I do not provide an example answer here.

 

 

I will give more guidelines and advice in the next lectures.

 

 

LEARNING OUTCOMES ASSESSED:

 

 

  1. Be able to describe the major tools used in gene technology and understand how such tools are used.
  2. Be able to demonstrate practical competence in key gene manipulation techniques.
  3. To have developed a range of key skills including information acquisition from web-based and library sources, self-directed learning, critical analysis of data, numeracy, writing and presentation of scientific reports.
  4. Communicate information effectively in written format.

 

 

 

Assessment Criteria.   These elements are not necessarily given equal weight in the overall assessment.

(Marker: please highlight relevant comments.)

 

Elements Upper 1st First Upper Second Lower second Third Fail
Quality of presentation

 

Great clarity.  Very concise. Entirely logical in structure.

Negligible errors in spelling & grammar.

Clear and concise.

Generally very logical.

Minimal errors in spelling & grammar.

Usually clear and concise. Only minor weaknesses in logic.

Few minor errors in spelling & grammar.

Some lack of clarity and not concise.

Some lapses in logic. Some errors in spelling & grammar.

Lacks clarity, and not concise.

Many errors in spelling & grammar.

Rambling, unclear. Difficult to understand.

Very many errors in spelling & grammar.

Quality and relevance of information Comprehensive, accurate information content. Entirely relevant to question. All important information. Minimal irrelevance/ inaccuracy. Considerable amount of information. Minor irrelevance/ inaccuracy. Reasonable amount of information. Some irrelevance/ inaccuracy. Limited amount of information. Much irrelevant or inaccurate. Negligible information. Mainly irrelevant/inaccurate.
Understanding

 

Excellent.

Critical insight and originality clearly evident.

No errors.

Very good understanding. Some critical insight/originality shown. Negligible errors

 

Substantial understanding.

Limited appreciation of nuances/wider perspectives.

 

Some understanding, but rather narrow.

 

Limited and patchy. Somewhat misses the point. Little or none. Completely misses the point.

 

Reading, research and referencing Full, critical coverage of literature.

Accurately cited and referenced.

Broad, critical coverage. Only minor errors in citation / referencing. Good but lacks critical insight.  Generally accurate citation / referencing. Adequate but uncritical.

Some errors in citation / referencing.

Narrow. Uncritical. Numerous errors in citation / referencing. Little or none.

Uncritical.  Citation / referencing absent or full of errors.

 

FEEDBACK: ADDITIONAL COMMENTS:

(Good points/areas for improvement)

 

General comments:

 

 

 

Three specific areas for improvement:

1.

 

 

2.

 

 

3.

 

 

 

 

 

Mark:                                 NAME OF MARKER: